101 Nvcc Final Exam Questions And Answers

Spermatogenesis begins at ________ {Ans: puberty}When an individual has two different alleles, they are ________ {Ans: Heterozygous}What is an Exon? {Ans: It's part opf the DNA sequence that are kept in the mRNA.}Give the complementary sequence of DNA on the opposite strand - and label the 5' and 3' end: 3' CATTAGAAGCTAAAGCGCTATAT 5' {Ans: 5' GTAATCTTCGATTTCGCGATATA 3'}Where does Translation occur? What about transcription? {Ans: Translation- Cytoplasm Transcription- Nucleus}Number of strands in RNA {Ans: One}A test cross is set up to determine: {Ans: The genotype of the dominant individual}Number of strands in DNA {Ans: Two}Pedigrees show the pattern of inheritance of several genetic disorders within a family. True or false? {Ans: False}What is the Coding DNA strand? {Ans: The pre-mRNA is the same as this sequence, just in RNA form.}Individual (single) chromosomes are arranged on the equator during ________ {Ans: Metaphase 2}What is a pedigree? {Ans: A chart that shows a single disorder within a family.}When an individual has two identical alleles, they are ________ {Ans: Homozygous}What is a codon? {Ans: Set of three mRNA bases.}What is incomplete dominance? {Ans: Where both phenotypes are merged; ie,